pTE4495
(Plasmid #80338)

• Purpose: mammalian expression MbCpf1 nuclease and Mb crRNA
• Depositing Lab: Ervin Welker
• Publication: Toth et al Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 4654
• Total vector size (bp): 9948
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Mb crRNA
• Alt name: Moraxella bovoculi 237 CRISPR RNA
• Species: Moraxella bovoculi
• Insert Size (bp): 42
• Promoter: human U6

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: AAAACAGGAAGGCAAAATGC

Gene/Insert 2

• Gene/Insert name: MbCpf1
• Alt name: Moraxella bovoculi 237 Cpf1 nuclease
• Insert Size (bp): 4119
• Promoter: CMV
• Tags / Fusion Proteins:
  • NLS (C terminal on insert)
  • 3xHA (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry