-
PurposeFluorescent Reporter for Dopaminergic Neuron Differentiation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80337 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV2.5
- Backbone size w/o insert (bp) 4840
- Total vector size (bp) 7340
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namerat TH promoter
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2500
-
GenBank IDAF014956
-
Entrez GeneTh (a.k.a. The)
- Promoter rat Tyrosine hydroxylase
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sfi I (destroyed during cloning)
- 3′ cloning site Alu I (not destroyed)
- 5′ sequencing primer GAGTGGCCAACTCCATCACT
- 3′ sequencing primer GAGTTCATGCGCTTCAAGGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV2.5-THP-GFP/WGA was a gift from Kwang-Soo Kim (Addgene plasmid # 80337 ; http://n2t.net/addgene:80337 ; RRID:Addgene_80337) -
For your References section:
Expression of transgenes in midbrain dopamine neurons using the tyrosine hydroxylase promoter. Oh MS, Hong SJ, Huh Y, Kim KS. Gene Ther. 2009 Mar;16(3):437-40. doi: 10.1038/gt.2008.148. Epub 2008 Sep 18. 10.1038/gt.2008.148 PubMed 18800154