pCiVSP(C363S)-SD64TF
(Plasmid
#80334)
-
PurposeExpresses Ciona VSP (without phosphatase activity) in Xenopus Oocyte
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80334 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSD64TF
- Backbone size w/o insert (bp) 3250
-
Vector typeXenopus Oocyte Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCiona intestinalis voltage-sensing phosphatase (C363S)
-
Alt nameCi-VSP (C363S)
-
SpeciesCiona intestinalis
-
Insert Size (bp)1731
-
MutationChanged Cysteine 363 to Serine
-
GenBank IDNM_001033826
-
Entrez Genevsp
- Promoter SP6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CTTGTTCTTTTTGCAGAAGCTC
- 3′ sequencing primer ACTCCATTCGGGTGTTCTTGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCiVSP(C363S)-SD64TF was a gift from Yasushi Okamura (Addgene plasmid # 80334 ; http://n2t.net/addgene:80334 ; RRID:Addgene_80334) -
For your References section:
Phosphoinositide phosphatase activity coupled to an intrinsic voltage sensor. Murata Y, Iwasaki H, Sasaki M, Inaba K, Okamura Y. Nature. 2005 Jun 30;435(7046):1239-43. Epub 2005 May 18. 10.1038/nature03650 PubMed 15902207