Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCiVSP(C363S)-SD64TF
(Plasmid #80334)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80334 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSD64TF
  • Backbone size w/o insert (bp) 3250
  • Vector type
    Xenopus Oocyte Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ciona intestinalis voltage-sensing phosphatase (C363S)
  • Alt name
    Ci-VSP (C363S)
  • Species
    Ciona intestinalis
  • Insert Size (bp)
    1731
  • Mutation
    Changed Cysteine 363 to Serine
  • GenBank ID
    NM_001033826
  • Entrez Gene
    vsp
  • Promoter SP6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CTTGTTCTTTTTGCAGAAGCTC
  • 3′ sequencing primer ACTCCATTCGGGTGTTCTTGAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCiVSP(C363S)-SD64TF was a gift from Yasushi Okamura (Addgene plasmid # 80334 ; http://n2t.net/addgene:80334 ; RRID:Addgene_80334)
  • For your References section:

    Phosphoinositide phosphatase activity coupled to an intrinsic voltage sensor. Murata Y, Iwasaki H, Sasaki M, Inaba K, Okamura Y. Nature. 2005 Jun 30;435(7046):1239-43. Epub 2005 May 18. 10.1038/nature03650 PubMed 15902207