-
PurposeExpresses Danio rerio VSP with separated EGFP in mammalian cell
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80333 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepIRES2-EGFP
-
Backbone manufacturerClonetech
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDaino rerio voltage-sensing phosphatase
-
Alt nameDr-VSP
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1536
-
GenBank IDAB308476
-
Entrez Genetpte (a.k.a. tpip, vsp, wu:fd20e11, wu:fi24b06)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer GCAGAGCTGGTTTAGTGAACCG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDrVSP-IRES2-EGFP was a gift from Yasushi Okamura (Addgene plasmid # 80333 ; http://n2t.net/addgene:80333 ; RRID:Addgene_80333) -
For your References section:
Enzyme domain affects the movement of the voltage sensor in ascidian and zebrafish voltage-sensing phosphatases. Hossain MI, Iwasaki H, Okochi Y, Chahine M, Higashijima S, Nagayama K, Okamura Y. J Biol Chem. 2008 Jun 27;283(26):18248-59. doi: 10.1074/jbc.M706184200. Epub 2008 Mar 28. 10.1074/jbc.M706184200 PubMed 18375390