pHAGE-RSV-tdTomato-2A-GCaMP6s
(Plasmid #80316)

• Purpose: Fluorescent reporter for calcium signaling
• Depositing Lab: Darrell Kotton
• Publication: Liberti WA et al Nat Neurosci. 2016 Oct 10. doi: 10.1038/nn.4405.

Backbone

• Vector backbone: pHAGE
• Backbone manufacturer: Richard Mulligan
• Total vector size (bp): 8953
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: tdTomato
• Insert Size (bp): 1428
• Promoter: RSV

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: ggtacagtgcaggggaaagaat
• 3′ sequencing primer: CGTGATGAGTCGACCATGGT

Gene/Insert 2

• Gene/Insert name: GCaMP6s
• Species: Synthetic
• Insert Size (bp): 1353
• Promoter: RSV

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: tgttcctgtacggcatggacga
• 3′ sequencing primer: gctattgcttcccgtatggctttc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry