pBPGUw-HACK-G4>QF2
(Plasmid
#80277)
-
PurposeGAL4->QF2 HACK construct compatible with GMR attP integrated insertions. Contains 5' and 3' GAL4 homology arms and gRNAs.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80277 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepBPGUw
-
Backbone manufacturerJanelia Research Campus
- Backbone size w/o insert (bp) 2600
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameQF2
-
SpeciesSynthetic
-
Insert Size (bp)1053
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGCATTCTGGAACAAAGACGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBPGUw-HACK-G4>QF2 was a gift from Christopher Potter (Addgene plasmid # 80277 ; http://n2t.net/addgene:80277 ; RRID:Addgene_80277) -
For your References section:
Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Lin CC, Potter CJ. Genetics. 2016 Jun 22. pii: genetics.116.191783. 10.1534/genetics.116.191783 PubMed 27334272
Map uploaded by the depositor.
