non-targeting control gRNA (BRDN0001162235)
(Plasmid
#80261)
-
Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNA
-
Depositing Labs
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80261 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonelentiGuide-Puro
-
Backbone manufacturerZhang Lab (Addgene plasmid # 52963)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNon-targeting control gRNA
-
gRNA/shRNA sequenceTCAGCAAAGGACGAAACAAA
-
SpeciesH. sapiens (human)
- Promoter hU6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer U6-F
- 3′ sequencing primer pS2-R (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
non-targeting control gRNA (BRDN0001162235) was a gift from John Doench & David Root (Addgene plasmid # 80261 ; http://n2t.net/addgene:80261 ; RRID:Addgene_80261) -
For your References section:
Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Doench JG, Fusi N, Sullender M, Hegde M, Vaimberg EW, Donovan KF, Smith I, Tothova Z, Wilen C, Orchard R, Virgin HW, Listgarten J, Root DE. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437. 10.1038/nbt.3437 PubMed 26780180
