pMS1088
(Plasmid #80159)

• Purpose: pET-Duet for bacterial expression of Cys-NuG2(4x)-Ald and co-expression of Mycobacterium tuberculosis Formylglycine Generating Enzyme
• Depositing Lab: Marcelo Sousa
• Publication: Walder et al J Am Chem Soc. 2017 Jul 5. doi: 10.1021/jacs.7b02958.

Backbone

• Vector backbone: pET-32 Xa/LIC
• Backbone manufacturer: EMD Millipore
• Backbone size w/o insert (bp): 6250
• Total vector size (bp): 7446
• Modifications to backbone: The backbone was initially modified as described in Lee, C.-D. et al. An improved SUMO fusion protein system for effective production of native proteins. Protein Sci. Publ. Protein Soc. 17, 1241–1248 (2008). We then switched the Ampicillin resistance to Kanamycin.

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: HisSUMO-Cys-4xNuG2-Ald
• Species: Synthetic
• Insert Size (bp): 1125
• Promoter: T7
• Tag / Fusion Protein:
  • HisSUMO (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SfoI (unknown if destroyed)
• 3′ cloning site: SacI (unknown if destroyed)
• 5′ sequencing primer: taatacgactcactatagg
• 3′ sequencing primer: GATTATGCGGCCGTGTACAA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The vector backbone containing the His-SUMO tag was obtained from Dr. Wang of the Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan. (IMB, AS).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry