Skip to main content
Addgene

Banshee RunxDN mCherry
(Plasmid #80158)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80158 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Banshee
  • Backbone manufacturer
    Dr. John Rossi, Beckman Research Institute of the City of Hope, CA
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Runx1
  • Species
    M. musculus (mouse)
  • Mutation
    DN--truncated version of the Runx1 protein containing only the DNA binding domain.
  • Entrez Gene
    Runx1 (a.k.a. AML1, CBF-alpha-2, Cbfa2, Pebp2a2, Pebpa2b)
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • IRES-mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GCCCTTTGTACACCCTAAGCCT
  • 3′ sequencing primer mCherry-R or TCAAGAAGACAGGGCCAGGTTT
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Banshee RunxDN mCherry was a gift from Ellen Rothenberg (Addgene plasmid # 80158 ; http://n2t.net/addgene:80158 ; RRID:Addgene_80158)
Related items:
Commonly requested with: