Banshee Runx1FL mCherry
(Plasmid #80157)

• Purpose: retroviral expression of Runx1Fl and mCherry
• Depositing Lab: Ellen Rothenberg
• Publication: Rothenberg lab plasmids (unpublished)

Backbone

• Vector backbone: Banshee
• Backbone manufacturer: Dr. John Rossi, Beckman Research Institute of the City of Hope, CA
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Runx1
• Species: M. musculus (mouse)
• Entrez Gene: Runx1 (a.k.a. AML1, CBF-alpha-2, Cbfa2, Pebp2a2, Pebpa2b)
• Tags / Fusion Proteins:
  • HA (C terminal on insert)
  • IRES-mCherry (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GCCCTTTGTACACCCTAAGCCT
• 3′ sequencing primer: mCherry-R or TCAAGAAGACAGGGCCAGGTTT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry