Skip to main content
Addgene
Open Menu

MELOPS
(Plasmid #80151)

Print

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80151 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
Add to Cart
DNA 80151-D50 50 μg of DNA in Tris buffer $495 *
Add to Cart
DNA 80151-D100 100 μg of DNA in Tris buffer $585 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pCR3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5537
  • Total vector size (bp) 8861
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    OCA2
  • Alt name
    P Protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2517
  • Mutation
    nonpathologic polymorphism D257A, pore mutation V443I
  • GenBank ID
    NM_000275
  • Entrez Gene
    OCA2 (a.k.a. BEY, BEY1, BEY2, BOCA, D15S12, EYCL, EYCL2, EYCL3, HCL3, P, PED, SHEP1)
  • Promoter CMV
  • Tag / Fusion Protein
    • mNectarine in first luminal loop

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CACCTTCCAGGGTCAAGGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was derived from pCR3/OCA2-HA (Sitaram A, et al. (2009) Localization to mature melanosomes by virtue of cytoplasmic dileucine motifs is required for human OCA2 function. Mol Biol Cell 20(5):1464–1477)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MELOPS was a gift from Santiago Di Pietro (Addgene plasmid # 80151 ; http://n2t.net/addgene:80151 ; RRID:Addgene_80151)

  • For your References section:

    TPC2 controls pigmentation by regulating melanosome pH and size. Ambrosio AL, Boyle JA, Aradi AE, Christian KA, Di Pietro SM. Proc Natl Acad Sci U S A. 2016 May 17;113(20):5622-7. doi: 10.1073/pnas.1600108113. Epub 2016 May 2. 10.1073/pnas.1600108113 PubMed 27140606
Related items:
Commonly requested with: