pGCaMP6m-N3-TPC2
(Plasmid #80147)

• Purpose: GCaMP6 is a genetically encoded fluorescent Ca2+ sensor . TPC2-GCaMP6 allows the visualization of Ca2+ release from intracellular Ca2+ stores in real time
• Depositing Lab: Santiago Di Pietro
• Publication: Ambrosio et al Mol Biol Cell. 2015 Sep 15;26(18):3263-74. doi: 10.1091/mbc.E15-01-0058. Epub 2015 Jul 22.

Backbone

• Vector backbone: pGCaMP6m-N3
• Backbone size w/o insert (bp): 5353
• Total vector size (bp): 7609
• Modifications to backbone: EGFP in pEGFP-N3 was replaced by GCaMP6m (BamHI-NotI) to generate pGCaMP6m-N3
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TPCN2
• Alt name: TPC2
• Species: H. sapiens (human)
• Insert Size (bp): 2256
• Entrez Gene: TPCN2 (a.k.a. SHEP10, TPC2)
• Promoter: CMV
• Tag / Fusion Protein:
  • GCaMP6m (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CCTCTACAAATGTGGTATGG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry