Skip to main content
Addgene

pcDNA4/TO/FLAG-hPMR1-Tev-Bio
(Plasmid #80125)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80125 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCDNA4/TO
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 5078
  • Total vector size (bp) 6587
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PXDNL-003
  • Alt name
    hPMR1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1910
  • GenBank ID
    BC132813
  • Entrez Gene
    PXDNL (a.k.a. PMR1, PRM1, VPO2)
  • Promoter CMV promoter
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • biotinylation (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site ApaI (unknown if destroyed)
  • 5′ sequencing primer cggcgtgccgggtgttcatgggg
  • 3′ sequencing primer ggcgtccctgagccgggtgctttgtg
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Open Biosystems (catalog no. MHS 4426-99240274)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

hPMR1 corresponds to Ensembl transcript PXDNL-003

Please note that the hPMR1 insert in this plasmid is numbered starting with the first methionine in GenBank reference sequence BC132813. This plasmid does not encode the 1463 aa PXDNL protein in GenBank NM_144651.4

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA4/TO/FLAG-hPMR1-Tev-Bio was a gift from Daniel Schoenberg (Addgene plasmid # 80125 ; http://n2t.net/addgene:80125 ; RRID:Addgene_80125)

  • For your References section:

    Identification of the human PMR1 mRNA endonuclease as an alternatively processed product of the gene for peroxidasin-like protein. Gu SQ, Bakthavachalu B, Han J, Patil DP, Otsuka Y, Guda C, Schoenberg DR. RNA. 2012 Jun;18(6):1186-96. doi: 10.1261/rna.031369.111. Epub 2012 Apr 27. 10.1261/rna.031369.111 PubMed 22543864
Related items:
Commonly requested with: