pX330-UGCG-KO
(Plasmid #80010)

• Purpose: gRNA to knock out expression of UGCG gene. The product of this gene catalyzes the first step in synthesis of glycosphingolipids.
• Depositing Lab: Sriram Neelamegham
• Publication: Stolfa et al Sci Rep. 2016 Jul 26;6:30392. doi: 10.1038/srep30392.

Backbone

• Vector backbone: pX330-U6-Chimeric_BB-CBh-hSpCas9
• Backbone size w/o insert (bp): 8506
• Total vector size (bp): 8526
• Modifications to backbone: Guide RNA for UGCG gene cloned in BbsI restriction site
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: UGCG
• gRNA/shRNA sequence: GCTGTGGCTGATGCATTTCA
• Species: H. sapiens (human)
• Entrez Gene: UGCG (a.k.a. GCS, GLCT1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: LKO.1 5'

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Cloning vector, pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene 42230), was produced in Dr. Feng Zhang's lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry