pCSII-EF-miRFP670v1-hGem(1/110)
(Plasmid #80006)

• Purpose: hGem(1/110) fused with near-infrared fluorescent protein miRFP670v1 (S/G2/M phase cell cycle reporter)
• Depositing Lab: Vladislav Verkhusha
• Publication: Shcherbakova et al Nat Commun. 2016 Aug 19;7:12405. doi: 10.1038/ncomms12405.

Backbone

• Vector backbone: pCSII-EF-MCS
• Backbone manufacturer: Dr. Hiroyuki Miyoshi (RIKEN, Tsukuba, Japan)
• Total vector size (bp): 10483
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: hGeminin (1/110)
• Species: H. sapiens (human)
• Entrez Gene: GMNN (a.k.a. Gem, MGORS6)
• Promoter: EF-1 alpha
• Tag / Fusion Protein:
  • miRFP670v1 (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ggttcattctcaagcctcagacagtgg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The original plasmids for cell cycle analysis (Fucci system, Cell, 2008; 132:487-98) were created by Dr. Atsushi Miyawaki (RIKEN Brain Science Institute, Saitama, Japan)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry