Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

rgef-1p::NmBirA
(Plasmid #79971)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79971 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBD95
  • Backbone manufacturer
    Vidal et al
  • Backbone size w/o insert (bp) 7059
  • Total vector size (bp) 8349
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BirA
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    1170
  • Promoter rgef
  • Tag / Fusion Protein
    • NLS::myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer atgaaggataatactgttcc
  • 3′ sequencing primer ggaaacagttatgtttggtatattgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    rgef-1p::NmBirA was a gift from Baris Tursun (Addgene plasmid # 79971 ; http://n2t.net/addgene:79971 ; RRID:Addgene_79971)
  • For your References section:

    A tissue-specific protein purification approach in Caenorhabditis elegans identifies novel interaction partners of DLG-1/Discs large. Waaijers S, Munoz J, Berends C, Ramalho JJ, Goerdayal SS, Low TY, Zoumaro-Djayoon AD, Hoffmann M, Koorman T, Tas RP, Harterink M, Seelk S, Kerver J, Hoogenraad CC, Bossinger O, Tursun B, van den Heuvel S, Heck AJ, Boxem M. BMC Biol. 2016 Aug 9;14:66. doi: 10.1186/s12915-016-0286-x. 10.1186/s12915-016-0286-x PubMed 27506200