rgef-1p::NmBirA
(Plasmid #79971)

• Purpose: encodes E.coli biotin-ligase under neuronal promotor for C.elegans
• Depositing Lab: Baris Tursun
• Publication: Waaijers et al BMC Biol. 2016 Aug 9;14:66. doi: 10.1186/s12915-016-0286-x.

Backbone

• Vector backbone: pBD95
• Backbone manufacturer: Vidal et al
• Backbone size w/o insert (bp): 7059
• Total vector size (bp): 8349
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BirA
• Species: C. elegans (nematode)
• Insert Size (bp): 1170
• Promoter: rgef
• Tag / Fusion Protein:
  • NLS::myc (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: atgaaggataatactgttcc
• 3′ sequencing primer: ggaaacagttatgtttggtatattgg

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry