pMA7-SacB
(Plasmid #79968)

• Purpose: TM-MAGE strain
• Depositing Lab: Morten Sommer
• Publication: Lennen et al Nucleic Acids Res. 2016 Feb 29;44(4):e36. doi: 10.1093/nar/gkv1090. Epub 2015 Oct 22.

Backbone

• Vector backbone: pBAD24
• Backbone size w/o insert (bp): 4542
• Total vector size (bp): 7337
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Lambda Red recombinase beta subunit
• Alt name: beta
• Species: Escherichia coli (EcNR1)
• GenBank ID:
• Promoter: pBAD

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GTAACAAAGCGGGACCAAAG

Gene/Insert 2

• Gene/Insert name: DNA adenine methylase
• Alt name: dam
• Species: Escherichia coli K-12 MG1655
• GenBank ID:
• Promoter: pBAD

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ACGACTTATTGCCGCTCTGT

Gene/Insert 3

• Gene/Insert name: Levansucrase
• Alt name: sacB
• Species: Escherichia coli (DA16543)

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TACTTTGGCGTCACCCCTTA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry