AAVS1_Puro_PGK1_3xFLAG_Twin_Strep_EZH2
(Plasmid
#79902)
-
PurposeGene Addition of 3xFLAG_Twin_Strep_EZH2 to the AAVS1 Genomic Safe Harbor Locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79902 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAVS1_Puro_PGK1_3xFLAG_Twin_Strep (Plasmid #68375)
-
Vector typeMammalian Expression, CRISPR, TALEN
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xFLAG_Twin_Strep_EZH2
-
SpeciesH. sapiens (human)
- Promoter PGK1
-
Tag
/ Fusion Protein
- 3xFLAG_Twin_Strep (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tagtgtgggccctgttcctg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Use in combination with eSpCas9(1.1)_No_FLAG_AAVS1_T2 (Plasmid #79888)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1_Puro_PGK1_3xFLAG_Twin_Strep_EZH2 was a gift from Yannick Doyon (Addgene plasmid # 79902 ; http://n2t.net/addgene:79902 ; RRID:Addgene_79902) -
For your References section:
A Scalable Genome-Editing-Based Approach for Mapping Multiprotein Complexes in Human Cells. Dalvai M, Loehr J, Jacquet K, Huard CC, Roques C, Herst P, Cote J, Doyon Y. Cell Rep. 2015 Oct 7. pii: S2211-1247(15)01020-7. doi: 10.1016/j.celrep.2015.09.009. 10.1016/j.celrep.2015.09.009 PubMed 26456817