Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

SP_gRNA_pUC19_N_FancF_Left
(Plasmid #79892)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79892 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FancF_Site_1_Left
  • gRNA/shRNA sequence
    CCCTACTTCCGCTTTCACCT
  • Species
    H. sapiens (human)
  • Tag / Fusion Protein
    • None

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Human gRNA expression vector targeting FANCF-Site 1-Left as described in Nature Biotechnology 32, 569–576 (2014). This gRNA expression vector must be used in combination with pDR348 FANCF
(Plasmid #47510) and a Cas9 D10A nickase to tag FANCF at its N-terminus.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SP_gRNA_pUC19_N_FancF_Left was a gift from Yannick Doyon (Addgene plasmid # 79892 ; http://n2t.net/addgene:79892 ; RRID:Addgene_79892)
  • For your References section:

    A Scalable Genome-Editing-Based Approach for Mapping Multiprotein Complexes in Human Cells. Dalvai M, Loehr J, Jacquet K, Huard CC, Roques C, Herst P, Cote J, Doyon Y. Cell Rep. 2015 Oct 7. pii: S2211-1247(15)01020-7. doi: 10.1016/j.celrep.2015.09.009. 10.1016/j.celrep.2015.09.009 PubMed 26456817