Skip to main content
Addgene

pMT-ubb-NLS-BirA-2a-mCherry
(Plasmid #79886)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79886 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMT
  • Backbone size w/o insert (bp) 6903
  • Total vector size (bp) 8993
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Biotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    2090
  • Promoter Ubiquitin
  • Tag / Fusion Protein
    • 3x HA (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACATGGGAGAAGTGCAAAACA
  • 3′ sequencing primer gcatgcgtttaaacccggg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Ubiquitin promoter from Addgene plasmid 27320 (Mosimann et al., 2011)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMT-ubb-NLS-BirA-2a-mCherry was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 79886 ; http://n2t.net/addgene:79886 ; RRID:Addgene_79886)
  • For your References section:

    Biotagging of Specific Cell Populations in Zebrafish Reveals Gene Regulatory Logic Encoded in the Nuclear Transcriptome. Trinh LA, Chong-Morrison V, Gavriouchkina D, Hochgreb-Hagele T, Senanayake U, Fraser SE, Sauka-Spengler T. Cell Rep. 2017 Apr 11;19(2):425-440. doi: 10.1016/j.celrep.2017.03.045. 10.1016/j.celrep.2017.03.045 PubMed 28402863