pMT-ubb-NLS-BirA-2a-mCherry
(Plasmid #79886)

• Purpose: Ubiquitin promoter driving HA-tagged biotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein; flanked by Tol2 sequences
• Depositing Lab: Tatjana Sauka-Spengler
• Publication: Trinh et al Cell Rep. 2017 Apr 11;19(2):425-440. doi: 10.1016/j.celrep.2017.03.045.

Backbone

• Vector backbone: pMT
• Backbone size w/o insert (bp): 6903
• Total vector size (bp): 8993
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Biotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
• Species: D. rerio (zebrafish)
• Insert Size (bp): 2090
• Promoter: Ubiquitin
• Tag / Fusion Protein:
  • 3x HA (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACATGGGAGAAGTGCAAAACA
• 3′ sequencing primer: gcatgcgtttaaacccggg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Ubiquitin promoter from Addgene plasmid 27320 (Mosimann et al., 2011)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry