pMT-ubb-Avi-Cerulean-RanGAP
(Plasmid #79881)

• Purpose: Ubiquitin promoter driving Avi-tagged protein containing Cerulean protein fused to the carboxy-terminal domain of avian Ran GTPase-activating protein 1 (RanGap1); flanked by Tol2 sequences
• Depositing Lab: Tatjana Sauka-Spengler
• Publication: Trinh et al Cell Rep. 2017 Apr 11;19(2):425-440. doi: 10.1016/j.celrep.2017.03.045.

Backbone

• Vector backbone: pMT
• Backbone size w/o insert (bp): 6820
• Total vector size (bp): 8428
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cerulean protein fused to the carboxy-terminal domain of avian Ran GTPase-activating protein 1 (RanGap1)
• Species: G. gallus (chicken)
• Insert Size (bp): 1608
• GenBank ID: NM_001006237.1
• Entrez Gene: RANGAP1
• Promoter: Ubiquitin promoter
• Tag / Fusion Protein:
  • Avi (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACATGGGAGAAGTGCAAAACA
• 3′ sequencing primer: taatacgactcactatagggag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Ubiquitin promoter from Addgene plasmid 27320 (Mosimann et al., 2011)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry