-
PurposeEncodes Cas1+2 and a CRISPR array
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79879 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDF-1b
- Total vector size (bp) 6068
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCas1
-
SpeciesE. coli
-
GenBank IDNP_417235.1
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CACGCGGTTGGGAATGTAAT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCas2
-
SpeciesE. coli
-
GenBank IDNP_417234.2
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer CACTGTTGTACCGAAAGCTTT
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameCRISPR Array
-
SpeciesE. coli (K12)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer CCGGCTCGTATGTTGTGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBased on Plasmid #72676 from Udi Qimron.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWUKI 1+2 was a gift from George Church (Addgene plasmid # 79879 ; http://n2t.net/addgene:79879 ; RRID:Addgene_79879) -
For your References section:
Molecular recordings by directed CRISPR spacer acquisition. Shipman SL, Nivala J, Macklis JD, Church GM. Science. 2016 Jun 9. pii: aaf1175. 10.1126/science.aaf1175 PubMed 27284167