pJMP3
(Plasmid #79875)

• Purpose: Bacillus subtilis sgRNA expression vector; integrates into thrC
• Depositing Labs: Carol Gross, Jason Peters, Stanley Qi
• Publication: Peters et al Cell. 2016 Jun 2;165(6):1493-506. doi: 10.1016/j.cell.2016.05.003. Epub 2016 May 26.

Backbone

• Vector backbone: pDG1731
• Backbone size w/o insert (bp): 6673
• Total vector size (bp): 7263
• Modifications to backbone: The rfp-targeting sgRNA RR1 was PCR-amplified from pgRNA-bacteria (Addgene #44251) using primers containing the veg promoter and EcoRI sites, digested with EcoRI, then ligated into either pDG1662 digested with EcoRI to generate pJMP2.
• Vector type: Bacterial Expression, CRISPR
• Selectable markers: Bacillus subtilis spectinomycin marker

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sgRNA RR1
• Alt name: sgRNA NT
• Alt name: anti-RFP sgRNA
• gRNA/shRNA sequence: AACTTTCAGTTTAGCGGTCT
• Species: Streptococcus pyogenes
• Promoter: veg

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: tgtccgttccatctgtgaga

Resource Information

• Supplemental Documents:
  • pJMP3
• A portion of this plasmid was derived from a plasmid made by: The rfp-targeting sgRNARR1 was PCR-amplified from pgRNA-bacteria (Addgene #44251) using primers containing the veg promoter and EcoRI sites, digested with EcoRI, then ligated into either pDG1731 digested with EcoRI to generate pJMP3
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that mutation T23S in the BSU homology region was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.