pAAV-Ef1a-DIO_EGFP-RandE3
(Plasmid #79872)

• Purpose: For generating adeno-associated virus to express RandE3 under the EF1a promoter in a 'Cre-on' dependent manner.
• Depositing Lab: Don Arnold
• Publication: Gross et al Nat Methods. 2016 Jun 6. doi: 10.1038/nmeth.3894.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pCAG
• Backbone size w/o insert (bp): 4026
• Total vector size (bp): 6910
• Vector type: Mammalian Expression, AAV, Cre/Lox, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: GFP-RandE3
• Species: R. norvegicus (rat), Synthetic
• Insert Size (bp): 1299
• Promoter: EF1a
• Tags / Fusion Proteins:
  • GFP (N terminal on insert)
  • HA

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: GTAATCCAGAGGTTGATTATCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry