-
PurposeFor generating adeno-associated virus to express GFE3 under the EF1a promoter in a 'Cre-on' dependent manner.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79871 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 5607
- Total vector size (bp) 6916
-
Vector typeMammalian Expression, AAV, Cre/Lox, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP-GFE3
-
SpeciesR. norvegicus (rat), Synthetic
-
Insert Size (bp)1305
- Promoter EF1a
-
Tags
/ Fusion Proteins
- GFP (N terminal on insert)
- HA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer GTAATCCAGAGGTTGATTATCG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-DIO_EGFP-GFE3 was a gift from Don Arnold (Addgene plasmid # 79871 ; http://n2t.net/addgene:79871 ; RRID:Addgene_79871) -
For your References section:
An E3-ligase-based method for ablating inhibitory synapses. Gross GG, Straub C, Perez-Sanchez J, Dempsey WP, Junge JA, Roberts RW, Trinh LA, Fraser SE, De Koninck Y, De Koninck P, Sabatini BL, Arnold DB. Nat Methods. 2016 Jun 6. doi: 10.1038/nmeth.3894. 10.1038/nmeth.3894 PubMed 27271196