Skip to main content
Addgene

PmarA-cfp
(Plasmid #79867)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79867 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    low-copy (SC101) origin vector pBbS5k
  • Backbone manufacturer
    BglBrick vectors
  • Backbone size w/o insert (bp) 3493
  • Total vector size (bp) 4445
  • Modifications to backbone
    Removed the extraneous copy of lacI and its promoter from the pBbS5k plasmid
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    A modified marRAB promoter upstream of a degradation tagged cfp
  • Insert Size (bp)
    952
  • Promoter modified marRAB promoter with inactivated MarR binding sites

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CAGTTTACTTTGCAGGGCTTC
  • 3′ sequencing primer GGCAATTCTGGAAGAAATAGCG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PmarA-cfp was a gift from Mary Dunlop (Addgene plasmid # 79867 ; http://n2t.net/addgene:79867 ; RRID:Addgene_79867)

  • For your References section:

    Stochastic expression of a multiple antibiotic resistance activator confers transient resistance in single cells. El_Meouche I, Siu Y, Dunlop MJ. Sci Rep. 2016 Jan 13;6:19538. doi: 10.1038/srep19538. 10.1038/srep19538 PubMed 26758525
Related items:
Commonly requested with: