pKA-207I10
(Plasmid #79845)

• Purpose: Expresses NLS-PpsR2-VP16-IRES-RpBphP1-mCherry-TetR under CMV promoter
• Depositing Lab: Vladislav Verkhusha
• Publication: Kaberniuk et al Nat Methods. 2016 May 9. doi: 10.1038/nmeth.3864.

Backbone

• Vector backbone: pIRES-mCherry
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 10100
• Modifications to backbone: IRES strength was reduced ~ 3-fold
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NLS-PpsR2-VP16-IRESI10-BphP1-mCherry-TetR
• Species: Rhodopseudomonas palustris
• Insert Size (bp): 6200
• Mutation: RpPpsR2 cysteine 439 changed to serine
• GenBank ID: KX063612 KX063613
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ggtaggcgtgtacggtgggag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: A RpBphP1 gene of R. palustris (NCBI Gene rpa1537) was provided by E. Giraud (Institute for Research and Development, France). A RpPpsR2 gene of R. palustris (NCBI Gene rpa1536) (accession code CAE26978) was provided by M. Papiz (Liverpool University, UK) and T. Beatty (University of British Columbia, Canada).
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry