Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV-160
(Plasmid #79840)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79840 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 6200
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLS-PpsR2-mVenus
  • Species
    Rhodopseudomonas palustris
  • Insert Size (bp)
    2300
  • Mutation
    RpPpsR2 cysteine 439 changed to serine
  • GenBank ID
    KX063612 CAE26978.1
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AsisI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer ggtaggcgtgtacggtgggag
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    A RpPpsR2 gene of R. palustris (NCBI Gene rpa1536) (accession code CAE26978) was provided by M. Papiz (Liverpool University, UK) and T. Beatty (University of British Columbia, Canada).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-160 was a gift from Vladislav Verkhusha (Addgene plasmid # 79840 ; http://n2t.net/addgene:79840 ; RRID:Addgene_79840)
  • For your References section:

    A bacterial phytochrome-based optogenetic system controllable with near-infrared light. Kaberniuk AA, Shemetov AA, Verkhusha VV. Nat Methods. 2016 May 9. doi: 10.1038/nmeth.3864. 10.1038/nmeth.3864 PubMed 27159085