pKA-141
(Plasmid #79832)

• Purpose: Expresses RpBphP1-mCherry
• Depositing Lab: Vladislav Verkhusha
• Publication: Kaberniuk et al Nat Methods. 2016 May 9. doi: 10.1038/nmeth.3864.

Backbone

• Vector backbone: pFC15K
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 5800
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: BphP1-mCherry
• Alt name: RpBphP1
• Species: Rhodopseudomonas palustris
• Insert Size (bp): 3000
• GenBank ID: NCBI Gene rpa1537 KX063613
• Promoter: CMVd1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: ggtaggcgtgtacggtgggag
• 3′ sequencing primer: GCA TCA CAA ATT TCA CAA ATA AAG C

Resource Information

• Supplemental Documents:
  • pKA-141
• A portion of this plasmid was derived from a plasmid made by: A RpBphP1 gene of R. palustris (NCBI Gene rpa1537) was provided by E. Giraud (Institute for Research and Development, France).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry