Skip to main content
Addgene

SAH0146-0.5-conP01
(Plasmid #79831)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79831 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSB4S5
  • Backbone manufacturer
    BioBrick
  • Backbone size w/o insert (bp) 3510
  • Total vector size (bp) 5586

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Blue fluorescent protein
  • Promoter conP01

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer pQE-RP
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mCherry
  • Promoter bla P3

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer ATTACCGCCTTTGAGTGAGC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SAH0146-0.5-conP01 was a gift from Katja Arndt (Addgene plasmid # 79831 ; http://n2t.net/addgene:79831 ; RRID:Addgene_79831)

  • For your References section:

    Long-range transcriptional interference in E. coli used to construct a dual positive selection system for genetic switches. Hoffmann SA, Kruse SM, Arndt KM. Nucleic Acids Res. 2016 Jun 2;44(10):e95. doi: 10.1093/nar/gkw125. Epub 2016 Feb 29. 10.1093/nar/gkw125 PubMed 26932362
Related items: