SAH0098-scrPX
(Plasmid
#79830)
-
PurposeTranscriptional interference assessment; no interfering promoter (scrambled)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSB4S5
-
Backbone manufacturerBioBrick
- Backbone size w/o insert (bp) 3510
- Total vector size (bp) 5071
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameBlue fluorescent protein
- Promoter scrPX (no promoter activity)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer pQE-RP (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
- Promoter bla P3
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer ATTACCGCCTTTGAGTGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SAH0098-scrPX was a gift from Katja Arndt (Addgene plasmid # 79830 ; http://n2t.net/addgene:79830 ; RRID:Addgene_79830) -
For your References section:
Long-range transcriptional interference in E. coli used to construct a dual positive selection system for genetic switches. Hoffmann SA, Kruse SM, Arndt KM. Nucleic Acids Res. 2016 Jun 2;44(10):e95. doi: 10.1093/nar/gkw125. Epub 2016 Feb 29. 10.1093/nar/gkw125 PubMed 26932362