pLLX13
(Plasmid #79825)

• Purpose: (Empty Backbone) Yeast and Bacterial shuttle vector, includes origin of transfer for conjugation, used for making a DNA capture vector
• Depositing Labs: Cammie Lesser, Stephen Lory
• Publication: Wolfgang et al Proc Natl Acad Sci U S A. 2003 Jul 8;100(14):8484-9. Epub 2003 Jun 18.

Backbone

• Vector backbone: pLLX13
• Backbone size (bp): 9977
• Vector type: Yeast and bacteria shuttle vector, contains origin of transfer for conjugation, can be used as backbone for a capture vector
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Cloning Information

• 5′ sequencing primer: GGCCGAAATCGGCAAGGATC
• 3′ sequencing primer: TTTATCACTGATAAGTTGGTGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Plasmid is from Dr. Stephen Lory's laboratory in the Microbiology and Immunobiology Department at Harvard Medical School.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Additional reference: Reeves AZ, Spears WE, Du J, Tan KY, Wagers AJ, Lesser CF. (2015) Engineering Escherichia coli into a protein delivery system for mammalian cells. ACS Synthetic Biology, 2015, May 15;4(5):644-54