pSAH0016
(Plasmid #79824)

• Purpose: Dual selection plasmid with lac operator, selection for binding with spectinomycin, for non-binding with chloramphenicol
• Depositing Lab: Katja Arndt
• Publication: Hoffmann et al Nucleic Acids Res. 2016 Jun 2;44(10):e95. doi: 10.1093/nar/gkw125. Epub 2016 Feb 29.

Backbone

• Vector backbone: pSB4X5
• Backbone manufacturer: BioBrick
• Backbone size w/o insert (bp): 2406
• Total vector size (bp): 4271
• Modifications to backbone: removal of backbone resistance from pSB4K5

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Spectinomycin, 25 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: cat
• Alt name: chloramphenicol acetyltransferase
• Alt name: with strong promoter with lac operator
• Insert Size (bp): 755
• Promoter: AATTCAAAAAAATGCTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTCCACACAT

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: pQE-RP

Gene/Insert 2

• Gene/Insert name: aadA
• Alt name: spectinomycin adenylyltransferase
• Alt name: with native promoter, opposite to cat
• Insert Size (bp): 1110
• Promoter: native aadA

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: PstI (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: ATTACCGCCTTTGAGTGAGC

Resource Information

• Supplemental Documents:
  • GenBank File

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry