pTag-RFP-C-h-Rab4a-c-Myc
(Plasmid #79800)

• Purpose: Express TagRFP labeled human Rab5a (GTPase located on recycling endosomal membranes).
• Depositing Lab: James Johnson
• Publication: Boothe et al Mol Metab. 2016 Feb 10;5(5):366-78. doi: 10.1016/j.molmet.2016.01.009. eCollection 2016 May.

Backbone

• Vector backbone: pTagRFP-C vector
• Backbone manufacturer: Evrogen
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Rab4a
• Species: H. sapiens (human)
• Entrez Gene: RAB4A (a.k.a. HRES-1, HRES-1/RAB4, HRES1, RAB4)
• Promoter: CMV
• Tags / Fusion Proteins:
  • TagRFP (N terminal on backbone)
  • myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: TagRFPmKate-F1 (AGGCCGACAAAGAGACCTAC)
• 3′ sequencing primer: SV40pA-R

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Industry MTA
  • Evrogen Ancillary Agreement for FP Distribution to Industry