Skip to main content
Addgene

pAM PAT-ProTRY GW
(Plasmid #79755)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79755 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Binary vector pAMPAT-MCS
  • Modifications to backbone
    exchange of Pro35S to ProTRY
  • Vector type
    Plant Expression
  • Promoter ProTRY
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gaccggcaacaggattcaatcttaag
  • 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Martin Hülskamp, Martina Pesch

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAM PAT-ProTRY GW was a gift from Nico Dissmeyer & Martin Hulskamp (Addgene plasmid # 79755 ; http://n2t.net/addgene:79755 ; RRID:Addgene_79755)
  • For your References section:

    Mutual control of intracellular localisation of the patterning proteins AtMYC1, GL1 and TRY/CPC in Arabidopsis. Pesch M, Schultheiss I, Digiuni S, Uhrig JF, Hulskamp M. Development. 2013 Aug;140(16):3456-67. doi: 10.1242/dev.094698. 10.1242/dev.094698 PubMed 23900543