Skip to main content
Addgene

pAM-PAT-ProTTG1 GW
(Plasmid #79753)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79753 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Binary vector pAMPAT-MCS
  • Modifications to backbone
    exchange of Pro35S to ProTTG1
  • Vector type
    Plant Expression
  • Promoter ProTTG1
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gaccggcaacaggattcaatcttaag
  • 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Martin Hülskamp, Daniel Buoyer

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAM-PAT-ProTTG1 GW was a gift from Nico Dissmeyer & Martin Hulskamp (Addgene plasmid # 79753 ; http://n2t.net/addgene:79753 ; RRID:Addgene_79753)

  • For your References section:

    Two-dimensional patterning by a trapping/depletion mechanism: the role of TTG1 and GL3 in Arabidopsis trichome formation. Bouyer D, Geier F, Kragler F, Schnittger A, Pesch M, Wester K, Balkunde R, Timmer J, Fleck C, Hulskamp M. PLoS Biol. 2008 Jun 10;6(6):e141. doi: 10.1371/journal.pbio.0060141. 10.1371/journal.pbio.0060141 PubMed 18547143
Related items: