Skip to main content
Addgene

pLEELA
(Plasmid #79752)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79752 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Binary vector pAMPAT-MCS
  • Modifications to backbone
    introduction of intron 3' of 35S promoter
  • Vector type
    Plant Expression
  • Promoter 2xPro35S
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gaccggcaacaggattcaatcttaag
  • 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Marc Jakoby
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLEELA was a gift from Nico Dissmeyer & Marc Jakoby (Addgene plasmid # 79752 ; http://n2t.net/addgene:79752 ; RRID:Addgene_79752)

  • For your References section:

    FRU (BHLH029) is required for induction of iron mobilization genes in Arabidopsis thaliana. Jakoby M, Wang HY, Reidt W, Weisshaar B, Bauer P. FEBS Lett. 2004 Nov 19;577(3):528-34. 10.1016/j.febslet.2004.10.062 PubMed 15556641
Related items:
Commonly requested with: