Skip to main content
Addgene

pAM-PAT-ProCDKA;1 GW
(Plasmid #79750)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79750 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Binary vector pAMPAT-MCS
  • Modifications to backbone
    exchange of Pro35S to ProCDKA;1
  • Vector type
    Plant Expression
  • Promoter ProCDKA;1
  • Selectable markers
    Basta
  • Tag / Fusion Protein
    • none

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gaccggcaacaggattcaatcttaag
  • 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Arp Schnittger, Moritz Nowack, Universität Hamburg

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAM-PAT-ProCDKA;1 GW was a gift from Nico Dissmeyer & Arp Schnittger (Addgene plasmid # 79750 ; http://n2t.net/addgene:79750 ; RRID:Addgene_79750)

  • For your References section:

    A positive signal from the fertilization of the egg cell sets off endosperm proliferation in angiosperm embryogenesis. Nowack MK, Grini PE, Jakoby MJ, Lafos M, Koncz C, Schnittger A. Nat Genet. 2006 Jan;38(1):63-7. Epub 2005 Nov 27. 10.1038/ng1694 PubMed 16311592
Related items: