Skip to main content
Addgene

AAV-FLEX-EGFP-mir30(Scn9a-scrambled)
(Plasmid #79671)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79671 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV
  • Backbone size w/o insert (bp) 4978
  • Total vector size (bp) 6087
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • gRNA/shRNA sequence
    Scn9a- scrambled control
  • Species
    M. musculus (mouse); jellyfish
  • GenBank ID
    NM_01290674.1
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer ctgacaacgggccacaactc
  • 3′ sequencing primer GTATATGTGCTGCCGAAGCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-FLEX-EGFP-mir30(Scn9a-scrambled) was a gift from Scott Sternson (Addgene plasmid # 79671 ; http://n2t.net/addgene:79671 ; RRID:Addgene_79671)
  • For your References section:

    Near-Perfect Synaptic Integration by Nav1.7 in Hypothalamic Neurons Regulates Body Weight. Branco T, Tozer A, Magnus CJ, Sugino K, Tanaka S, Lee AK, Wood JN, Sternson SM. Cell. 2016 Jun 16;165(7):1749-61. doi: 10.1016/j.cell.2016.05.019. 10.1016/j.cell.2016.05.019 PubMed 27315482