Skip to main content
Addgene

pRS315e_pGal-dCas9-SH3-pGal-PmCDA1-SHL
(Plasmid #79614)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79614 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRS315
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 12088
  • Modifications to backbone
    EcoRI site is mutated in Leu2
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    SpCas9
  • Species
    Streptococcus pyogenes
  • Mutation
    D10A and H840A for nuclease deficient Cas9
  • Promoter pGal1
  • Tag / Fusion Protein
    • SH3 domain (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tagcatctatgcgacacgg
  • 3′ sequencing primer gtaaaacgacggccagt
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    PmCDA1
  • Promoter pGal10
  • Tag / Fusion Protein
    • SHL (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer caggaaacagctatgac
  • 3′ sequencing primer gctctttacatttccacaac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This is derived from Addgene plasmid ID43804.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS315e_pGal-dCas9-SH3-pGal-PmCDA1-SHL was a gift from Akihiko Kondo (Addgene plasmid # 79614 ; http://n2t.net/addgene:79614 ; RRID:Addgene_79614)
  • For your References section:

    Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. Nishida K, Arazoe T, Yachie N, Banno S, Kakimoto M, Tabata M, Mochizuki M, Miyabe A, Araki M, Hara KY, Shimatani Z, Kondo A. Science. 2016 Aug 4. pii: aaf8729. 10.1126/science.aaf8729 PubMed 27492474