pRS315e_pGal-dCas9-SH3-pGal-PmCDA1-SHL
(Plasmid #79614)

• Purpose: Expresses dCas9-SH3 and PmCDA1-SHL in yeast cells
• Depositing Lab: Akihiko Kondo
• Publication: Nishida et al Science. 2016 Aug 4. pii: aaf8729.

Backbone

• Vector backbone: pRS315
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 12088
• Modifications to backbone: EcoRI site is mutated in Leu2
• Vector type: Yeast Expression
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: SpCas9
• Species: Streptococcus pyogenes
• Mutation: D10A and H840A for nuclease deficient Cas9
• Promoter: pGal1
• Tag / Fusion Protein:
  • SH3 domain (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tagcatctatgcgacacgg
• 3′ sequencing primer: gtaaaacgacggccagt

Gene/Insert 2

• Gene/Insert name: PmCDA1
• Promoter: pGal10
• Tag / Fusion Protein:
  • SHL (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: caggaaacagctatgac
• 3′ sequencing primer: gctctttacatttccacaac

Resource Information

• A portion of this plasmid was derived from a plasmid made by: This is derived from Addgene plasmid ID43804.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry