-
PurposeExpression of catalytic domain of mouse Tet2
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79554 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepScalps
- Backbone size w/o insert (bp) 7740
- Total vector size (bp) 10542
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTet2
-
Alt nameTen Eleven Translocation methylcytosine dioxygenase 2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2836
-
Mutationaa990-1912
-
GenBank IDNM_001040400
-
Entrez GeneTet2 (a.k.a. Ayu17-449, E130014J05Rik, mKIAA1546)
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCTTCTCGCTTCTGTTCG
- 3′ sequencing primer GTTGTCAAGCGATGAGGCGCGT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pScalps_Puro_mTet2 catalytic domain was a gift from Silvia Monticelli (Addgene plasmid # 79554 ; http://n2t.net/addgene:79554 ; RRID:Addgene_79554) -
For your References section:
TET2 Regulates Mast Cell Differentiation and Proliferation through Catalytic and Non-catalytic Activities. Montagner S, Leoni C, Emming S, Della Chiara G, Balestrieri C, Barozzi I, Piccolo V, Togher S, Ko M, Rao A, Natoli G, Monticelli S. Cell Rep. 2016 May 17;15(7):1566-79. doi: 10.1016/j.celrep.2016.04.044. Epub 2016 May 5. 10.1016/j.celrep.2016.04.044 PubMed 27160912
Map uploaded by the depositor.