Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRSETa-Amrose v3
(Plasmid #79539)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79539 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRSETa
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Amrose v3
  • Species
    Entacmaea quadricolor
  • Insert Size (bp)
    696
  • Promoter T7
  • Tags / Fusion Proteins
    • 6xHis (N terminal on backbone)
    • T7 epitope (N terminal on backbone)
    • Xpress tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer actagtcctaggGAAATTAATACGACTCACTATAGGGAGA
  • 3′ sequencing primer ATGCTAGTTATTGCTCAGCGGTGGCAGCAGCCAACTCAGC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSETa-Amrose v3 was a gift from Randolph Caldwell (Addgene plasmid # 79539 ; http://n2t.net/addgene:79539 ; RRID:Addgene_79539)
  • For your References section:

    Usefulness of a Darwinian system in a biotechnological application: evolution of optical window fluorescent protein variants under selective pressure. Schoetz U, Deliolanis NC, Ng D, Pauli J, Resch-Genger U, Kuhn E, Heuer S, Beisker W, Koster RW, Zitzelsberger H, Caldwell RB. PLoS One. 2014 Sep 5;9(9):e107069. doi: 10.1371/journal.pone.0107069. eCollection 2014. PONE-D-12-23517 [pii] PubMed 25192257