pAIDA1
(Plasmid #79180)

• Purpose: A construct with the AIDA surface expression system for display of a passenger protein flanked by His and Myc tags
• Depositing Lab: Gen Larsson
• Publication: Jarmander et al Microb Cell Fact. 2012 Sep 3;11:118. doi: 10.1186/1475-2859-11-118.

Backbone

• Vector backbone: pKM1D
• Backbone size w/o insert (bp): 3800
• Total vector size (bp): 3600
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Adhesin Involved in Diffuse Adherence
• Alt name: AIDA
• Species: Synthetic; E. coli
• Insert Size (bp): 1800
• Promoter: lacUV5
• Tags / Fusion Proteins:
  • His (N terminal on insert)
  • Myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: BclI (destroyed during cloning)
• 5′ sequencing primer: GAGCGGATAACAATTTCACACAGG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry