pETDuet-T7-Ct-WspR
(Plasmid #79166)

• Purpose: Dual expression of Ct biosensor and WspR WT under individual T7 promoters
• Depositing Lab: Ming Hammond
• Publication: Wang et al Nucleic Acids Res. 2016 Jul 5. pii: gkw580.

Backbone

• Vector backbone: pETDuet
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5420
• Total vector size (bp): 6554
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: WspR
• Species: P. areuginosa
• Insert Size (bp): 1041
• GenBank ID: NC_002516.2
• Entrez Gene: wspR (a.k.a. PA3702)
• Promoter: T7

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gatcgagatcgatctcgatccc
• 3′ sequencing primer: ttgtacacggccgcataatc

Gene/Insert 2

• Gene/Insert name: T7-Spinach2-Ct
• Insert Size (bp): 236
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTGTACACGGCCGCATAATC
• 3′ sequencing primer: CGCTTAATGCGCCGCTACAG

Resource Information

• Supplemental Documents:
  • See also https://benchling.com/s/Fpuu0bz1/edit

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry