pCOLA-T7-WspR:D70E
(Plasmid #79164)

• Purpose: Expresses constitutively active WspR D70E under a T7 promoter
• Depositing Lab: Ming Hammond
• Publication: Wang et al Nucleic Acids Res. 2016 Jul 5. pii: gkw580.

Backbone

• Vector backbone: pCOLADuet
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 3719
• Total vector size (bp): 4709
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: WspR
• Species: P. areuginosa
• Insert Size (bp): 1041
• Mutation: D70E
• GenBank ID: NC_002516.2
• Entrez Gene: wspR (a.k.a. PA3702)
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: ttgtacacggccgcataatc
• 3′ sequencing primer: gctagttattgctcagcgg

Resource Information

• Supplemental Documents:
  • Annotated GenBank file
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the WspR insert in this plasmid contains a P342S mutation compared to GenBank reference sequence NC_002516.2. This change was not intentional, and may have resulted from a PCR amplification error. The depositing lab has used this exact construct and the plasmid functions as described in the publication.

Also see https://benchling.com/s/DJkXzMM8/edit