pET31b-T7-Spinach2-Pl-B
(Plasmid #79161)

• Purpose: Expresses the Pl-B biosensor under a T7 promoter
• Depositing Lab: Ming Hammond
• Publication: Wang et al Nucleic Acids Res. 2016 Jul 5. pii: gkw580.

Backbone

• Vector backbone: pET31b+
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5700
• Total vector size (bp): 5575
• Modifications to backbone: Inserted at BglII/XhoI
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: T7-tRNA-Spinach2-Pl-B
• Insert Size (bp): 162
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CGCTTAATGCGCCGCTACAG
• 3′ sequencing primer: CCGGCGTAGAGGATCGAGATCT

Resource Information

• Supplemental Documents:
  • Also see https://benchling.com/s/ojSKzCFd/edit
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry