Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET31b-T7-Spinach2-Ct
(Plasmid #79158)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79158 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET31b+
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5700
  • Total vector size (bp) 5598
  • Modifications to backbone
    Inserted at BglII/XhoI
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    T7-tRNA-Spinach2-Ct
  • Insert Size (bp)
    169
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCTTAATGCGCCGCTACAG
  • 3′ sequencing primer CCGGCGTAGAGGATCGAGATCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET31b-T7-Spinach2-Ct was a gift from Ming Hammond (Addgene plasmid # 79158 ; http://n2t.net/addgene:79158 ; RRID:Addgene_79158)
  • For your References section:

    Next-generation RNA-based fluorescent biosensors enable anaerobic detection of cyclic di-GMP. Wang XC, Wilson SC, Hammond MC. Nucleic Acids Res. 2016 Jul 5. pii: gkw580. 10.1093/nar/gkw580 PubMed 27382070