Skip to main content
Addgene

pCAG-SpCas9-GFP-U6-gRNA
(Plasmid #79144)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79144 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-GFP (PX458)
  • Backbone manufacturer
    Addgene #48138
  • Total vector size (bp) 10243
  • Modifications to backbone
    Replaced CBh promoter with CAG promoter
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpCas9
  • Promoter CAG
  • Tag / Fusion Protein
    • 2A-GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (not destroyed)
  • 3′ cloning site BbsI (not destroyed)
  • 5′ sequencing primer ACTATCATATGCTTACCGTAAC
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was modified from Addgene plasmid #48138 and contains GFP cassette.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-SpCas9-GFP-U6-gRNA was a gift from Jizhong Zou (Addgene plasmid # 79144 ; http://n2t.net/addgene:79144 ; RRID:Addgene_79144)

  • For your References section:

    The ribosomal prolyl-hydroxylase OGFOD1 decreases during cardiac differentiation and modulates translation and splicing. Stoehr A, Kennedy L, Yang Y, Patel S, Lin Y, Linask KL, Fergusson M, Zhu J, Gucek M, Zou J, Murphy E. JCI Insight. 2019 May 21;5. pii: 128496. doi: 10.1172/jci.insight.128496. 10.1172/jci.insight.128496 PubMed 31112528
Related items:
Commonly requested with: