Skip to main content
Addgene

pSicoR (EGFP) shPnky-2
(Plasmid #79142)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79142 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSicoR
  • Backbone size w/o insert (bp) 7552
  • Vector type
    Mammalian Expression, Lentiviral, RNAi, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shPnky-2
  • gRNA/shRNA sequence
    GATGACGTGGAGAGGATTTTTCAAGAGAAAATCCTCTCCACGTCATCTTTTTTC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Gm30731 (a.k.a. Pnky, lnc-pou3f2)
  • Promoter U6 for the shRNA and CMV for EGFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer tgcaggggaaagaatagtagac
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSicoR (EGFP) shPnky-2 was a gift from Daniel Lim (Addgene plasmid # 79142 ; http://n2t.net/addgene:79142 ; RRID:Addgene_79142)

  • For your References section:

    The long noncoding RNA Pnky regulates neuronal differentiation of embryonic and postnatal neural stem cells. Ramos AD, Andersen RE, Liu SJ, Nowakowski TJ, Hong SJ, Gertz CC, Salinas RD, Zarabi H, Kriegstein AR, Lim DA. Cell Stem Cell. 2015 Apr 2;16(4):439-47. doi: 10.1016/j.stem.2015.02.007. Epub 2015 Mar 19. 10.1016/j.stem.2015.02.007 PubMed 25800779
Related items: